Mon ancêtre matrilinéaire (mitochondrial)
Rapport de mes résultats dans le cadre du programme The Genographic Project de la société National Geographic.
11 septembre 2008
HAPLOGROUP H
Your Branch on the Human Family Tree
Your DNA results identify you as belonging to a specific branch of the human
family tree called haplogroup H. Haplogroup H contains the following subgroups:
H, H*, H1, H1*, H10, H11, H11a, H12, H13, H14, H15, H1a, H1b, H1f, H2, H2*, H2a,
H2a1, H2b, H3, H4, H4a, H5, H5*, H5a, H5a1, H6a, H6a1, H6c, H7, H8, H9.
The map above shows the direction that your maternal ancestors took as they set
out from their original homeland in East Africa. While humans did travel many
different paths during a journey that took tens of thousands of years, the lines
above represent the dominant trends in this migration.
Over time, the descendants of your ancestors spread across Eurasia and today
make up the most frequent western European haplogroup. But before we can take
you back in time and tell their stories, we must first understand how modern
science makes this analysis possible.
How DNA Can Help
|
16093C, 16129A, 16316G, 16519C
ATTCTAATTTAAACTATTCTCTGTTCTTTCATGGGGAAGCAGATTTGGGTACCA |
The string of 569 letters shown above is your mitochondrial sequence, with the
letters A, C, T, and G representing the four nucleotides the chemical building
blocks of life that make up your DNA. The numbers at the top of the page refer
to the positions in your sequence where informative mutations have occurred in
your ancestors, and tell us a great deal about the history of your genetic
lineage.
Here's how it works. Every once in a while a mutation a random, natural (and
usually harmless) change occurs in the sequence of your mitochondrial DNA. Think
of it as a spelling mistake: one of the "letters" in your sequence may change
from a C to a T, or from an A to a G.
(Explore the Genetics Overview to learn more about population genetics.)
After one of these mutations occurs in a particular woman, she then passes it on
to her daughters, and her daughters' daughters, and so on. (Mothers also pass on
their mitochondrial DNA to their sons, but the sons in turn do not pass it on.)
Geneticists use these markers from people all over the world to construct one
giant mitochondrial family tree. As you can imagine, the tree is very complex,
but scientists can now determine both the age and geographic spread of each
branch to reconstruct the prehistoric movements of our ancestors.
By looking at the mutations that you carry, we can trace your lineage, ancestor
by ancestor, to reveal the path they traveled as they moved out of Africa. Our
story begins with your earliest ancestor. Who was she, where did she live, and
what is her story?
Your Ancestral Journey: What We Know Now
We will now take you back through the stories of your distant ancestors and show
how the movements of their descendants gave rise to your mitochondrial lineage.
Each segment on the map above represents the migratory path of successive groups
that eventually coalesced to form your branch of the tree. We start with your
oldest ancestor, "Eve," and walk forward to more recent times, showing at each
step the line of your ancestors who lived up to that point.
Mitochondrial Eve: The Mother of Us All
Ancestral Line: "Mitochondrial Eve"
Our story begins in Africa sometime between 150,000 and 170,000 years ago, with
a woman whom anthropologists have nicknamed "Mitochondrial Eve."
She was awarded this mythic epithet in 1987 when population geneticists
discovered that all people alive on the planet today can trace their maternal
lineage back to her.
But Mitochondrial Eve was not the first female human. Homo sapiens evolved in
Africa around 200,000 years ago, and the first hominids characterized by their
unique bipedal stature appeared nearly two million years before that. Though
Homo sapiens have been around for about 200,000 years, about 150,000 to 170,000
years ago, a woman was born from whom we are all descended. This happened 30,000
years after Homo sapiens evolved in Africa.
Eventually, for any number of reasons, all of the other lineages of people went
extinct, and "Mitochondrial Eve" as we call her, was the only female who had
descendants that are now living in the present day. We can all be traced back to
that one woman, who lived about 170,000 years ago.
Which begs the question, "So why Eve?"
Simply put, Eve was a survivor. A maternal line can become extinct for a number
of reasons. A woman may not have children, or she may bear only sons (who do not
pass her mtDNA to the next generation). She may fall victim to a catastrophic
event such as a volcanic eruption, flood, or famine, all of which have plagued
humans since the dawn of our species.
None of these extinction events happened to Eve’s line. It may have been simple
luck, or it may have been something much more. It was around this same time that
modern humans' intellectual capacity underwent what author Jared Diamond coined
the Great Leap Forward. Many anthropologists believe that the emergence of
language gave us a huge advantage over other early human species. Improved tools
and weapons, the ability to plan ahead and cooperate with one another, and an
increased capacity to exploit resources in ways we hadn't been able to earlier,
all allowed modern humans to rapidly migrate to new territories, exploit new
resources, and outcompete and replace other hominids, such as the Neandertals.
It is difficult to pinpoint the chain of events that led to Eves unique success,
but we can say with certainty that all of us trace our maternal lineage back to
this one woman.
The L Haplogroups: The Deepest Branches
Ancestral line: “Eve” > L1/L0
Mitochondrial Eve represents the root of the human family tree. Her descendents,
moving around within Africa, eventually split into two distinct groups,
characterized by a different set of mutations their members carry.
These groups are referred to as L0 and L1, and these individuals have the most
divergent genetic sequences of anybody alive today, meaning they represent the
deepest branches of the mitochondrial tree. Importantly, current genetic data
indicates that indigenous people belonging to these groups are found exclusively
in Africa. This means that, because all humans have a common female ancestor,
"Eve," and because the genetic data shows that Africans are the oldest groups on
the planet, we know our species originated there.
Haplogroups L1 and L0 likely originated in East Africa and then spread
throughout the rest of the continent. Today, these lineages are found at highest
frequencies in Africa's indigenous populations, the hunter-gatherer groups who
have maintained their ancestors' culture, language, and customs for thousands of
years.
At some point, after these two groups had coexisted in Africa for a few thousand
years, something important happened. The mitochondrial sequence of a woman in
one of these groups, L1, mutated. A letter in her DNA changed, and because many
of her descendants have survived to the present, this change has become a window
into the past. The descendants of this woman, characterized by this signpost
mutation, went on to form their own group, called L2. Because the ancestor of L2
was herself a member of L1, we can say something about the emergence of these
important groups: Eve begat L1, and L1 begat L2. Now we're starting to move down
your ancestral line.
Haplogroup L2: West Africa
Ancestral Line: "Eve" > L1/L0 > L2
L2 individuals are found in sub-Saharan Africa, and like their L1 predecessors,
they also live in Central Africa and as far south as South Africa. But whereas
L1/L0 individuals remained predominantly in eastern and southern Africa, your
ancestors broke off into a different direction, which you can follow on the map
above.
L2 individuals are most predominant in West Africa, where they constitute the
majority of female lineages. And because L2 individuals are found at high
frequencies and widely distributed along western Africa, they represent one of
the predominant lineages in African-Americans. Unfortunately, it is difficult to
pinpoint where a specific L2 lineage might have arisen. For an African-American
who is L2 the likely result of West Africans being brought to America during the
slave trade it is difficult to say with certainty exactly where in Africa that
lineage arose.
Fortunately, collaborative sampling with indigenous groups is currently underway
to help learn more about these types of questions and to possibly bridge the gap
that was created during those transatlantic voyages hundreds of years ago.
Haplogroup L3: Out of Africa
Ancestral Line: "Eve" > L1/L0 > L2 > L3
Your next signpost ancestor is the woman whose birth around 80,000 years ago
began haplogroup L3. It is a similar story: an individual in L2 underwent a
mutation to her mitochondrial DNA, which was passed onto her children. The
children were
successful, and their descendants ultimately broke away from the L2 clan,
eventually separating into a new group called L3. You can see above that this
has revealed another step in your ancestral line.
While L3 individuals are found all over Africa, including the southern reaches
of sub-Sahara, L3 is important for its movements north. You can follow this
movement of the map above, seeing first the expansions of L1/L0, then L2, and
followed by the northward migration of L3.
Your L3 ancestors were significant because they are the first modern humans to
have left Africa, representing the deepest branches of the tree found outside of
that continent.
Why would humans have first ventured out of the familiar African hunting grounds
and into unexplored lands? It is likely that a fluctuation in climate may have
provided the impetus for your ancestors' exodus out of Africa.
The African Ice Age was characterized by drought rather than by cold. Around
50,000 years ago the ice sheets of northern Europe began to melt, introducing a
period of warmer temperatures and moister climate in Africa. Parts of the
inhospitable Sahara briefly became habitable. As the drought-ridden desert
changed to savanna, the animals your ancestors hunted expanded their range and
began moving through the newly emerging green corridor of grasslands. Your
nomadic ancestors followed the good weather and plentiful game northward across
this Saharan Gateway, although the exact route they followed remains to be
determined.
Today, L3 individuals are found at high frequencies in populations across North
Africa. From there, members of this group went in a few different directions.
Some lineages within L3 testify to a distinct expansion event in the
mid-Holocene that headed south, and are predominant in many Bantu groups found
all over Africa. One group of individuals headed west and is primarily
restricted to Atlantic western Africa, including the islands of Cabo Verde.
Other L3 individuals, your ancestors, kept moving northward, eventually leaving
the African continent completely. These people currently make up around ten
percent of the Middle Eastern population, and gave rise to two important
haplogroups that went on to populate the rest of the world.
Haplogroup N: The Incubation Period
Ancestral line: "Eve" > L1/L0 > L2 > L3 > N
Your next signpost ancestor is the woman whose descendants formed haplogroup N.
Haplogroup N comprises one of two groups that were created by the descendants of
L3.
The first of these groups, /4, was the result of the first great wave of
migration of modern humans to leave Africa. These people likely left the
continent across the Horn of Africa near Ethiopia, and their descendants
followed a coastal route eastward, eventually making it all the way to Australia
and Polynesia.
The second great wave, also of L3 individuals, moved north rather than east and
left the African continent across the Sinai Peninsula, in present-day Egypt.
Also faced with the harsh desert conditions of the Sahara, these people likely
followed the Nile basin, which would have proved a reliable water and food
supply in spite of the surrounding desert and its frequent sandstorms.
Descendants of these migrants eventually formed haplogroup N. Early members of
this group lived in the eastern Mediterranean region and western Asia, where
they likely coexisted for a time with other hominids such as Neandertals.
Excavations in Israel's Kebara Cave (Mount Carmel) have unearthed Neandertal
skeletons as recent as 60,000 years old, indicating that there was both
geographic and temporal overlap of these two hominids.
The ancient members of haplogroup N spawned many sublineages, which went on to
populate much of the rest of the globe. They are found throughout Asia, Europe,
India, and the Americas.
Haplogroup R: Spreading Out
Ancestral line: "Eve" > L1/L0 > L2 > L3 > N > R
After several thousand years in the Near East, individuals belonging to a new
group called haplogroup R began to move out and explore the surrounding areas.
Some moved south, migrating back into northern Africa. Others went west across
Anatolia (present-day Turkey) and north across the Caucasus Mountains of Georgia
and southern Russia. Still others headed east into the Middle East, and on to
Central Asia. All of these individuals had one thing in common: they shared a
female ancestor from the N clan, a recent descendant of the migration out of
Africa.
The story of haplogroup R is complicated, however, because these individuals can
be found almost everywhere, and because their origin is quite ancient. In fact,
the ancestor of haplogroup R lived relatively soon after humans moved out of
Africa during the second wave, and her descendants undertook many of the same
migrations as her own group, N.
Because the two groups lived side by side for thousands of years, it is likely
that the migrations radiating out from the Near East comprised individuals from
both of these groups. They simply moved together, bringing their N and R
lineages to the same places around the same times. The tapestry of genetic lines
became quickly entangled, and geneticists are currently working to unravel the
different stories of haplogroups N and R, since they are found in many of the
same far-reaching places.
Haplogroup pre-HV: In the Near East
Ancestral line: “Eve” > L1/L0 > L2 > L3 > N > R > pre-HV
Descending from haplogroup R were a group of individuals who formed a western
Eurasian lineage. The descendants of pre-HV live in high frequencies in the
Anatolian-Caucasus region and Iran. While members of this group can also be
found in the Indus Valley near the Pakistan-India border, their presence is
considered the result of a subsequent migration eastward of individuals out of
the Near East.
Individuals in haplogroup pre-HV can be found all around the Red Sea and widely
throughout the Near East. While this genetic lineage is common in Ethiopia and
Somalia, individuals from this group are found at highest frequency in Arabia.
Because of their close genetic and geographic proximity to other western
Eurasian clusters, members of this group living in eastern Africa are the likely
result of more recent migrations back into the continent.
As we have seen from haplogroups N and R, descendants from these western
Eurasian lineages used the Near East as a home base of sorts, radiating from
that region to populate much of the rest of the world. Their descendants
comprise all of the western Eurasian genetic lineages, and about half of the
eastern Eurasian mtDNA gene pool. Some individuals moved across the Middle East
into Central Asia and the Hindus Valley near western India. Some moved south,
heading back into the African
homeland from where their ancestors had recently departed.
Haplogroup pre-HV is of particular importance because over the course of several
thousand years, its descendants split off and formed their own group, called HV.
This group thanks in large part to a brutal cold spell that was about to set in
gave rise to the two most prevalent female lineages found in Western Europe.
Haplogroup HV: The Near East and Beyond
Ancestral Line: “Eve” > L1/L0 > L2 > L3 > N > R > pre-HV > NV
While some descendants of these ancestral lineages moved out across Central
Asia, the Indus Valley, and even back into Africa, your ancestors remained in
the Near East. Descending from haplogroup pre-HV, they formed a new group,
characterized by a unique set of mutations, called haplogroup HV.
Haplogroup NV is a west Eurasian haplogroup found throughout the Near East,
including Anatolia (present-day Turkey) and the Caucasus Mountains of southern
Russia and the republic of Georgia. It is also found in parts of East Africa,
particularly in Ethiopia, where its presence there indicates recent Near Eastern
gene flow, likely the result of the Arab slave trade over the last two
millennia.
Much earlier, around 30,000 years ago, some members of HV moved north across the
Caucasus Mountains and west across Anatolia, their lineages being carried into
Europe for the first time by the Cro-Magnon. Their arrival in Europe heralded
the end of the era of the Neandertals, a hominid species that inhabited Europe
and parts of western Asia from about 230,000 to 29,000 years ago. Better
communication skills, weapons, and resourcefulness probably enabled them to
outcompete Neandertals for scarce resources. Importantly, some descendants of HV
had already broken off and formed their own group, haplogroup H, and continued
the push into Western Europe.
Haplogroup H: Your Branch on the Tree
Ancestral Line: "Eve" > L1/L0 > L2 > L3 > N > R > pre-HV > HV > H
This wave of migration into western Europe marked the appearance and spread of
what archaeologists call the Aurignacian culture. The culture is distinguished
by significant innovations in methods of manufacturing tools, standardization of
tools, and use of a broader set of tool types, such as end-scrapers for
preparing animal skins and tools for woodworking.
Around 15,000 to 20,000 years ago, colder temperatures and a drier global
climate locked much of the world's fresh water at the polar ice caps, making
living conditions near impossible for much of the northern hemisphere. Early
Europeans retreated to the warmer climates of the Iberian Peninsula, Italy, and
the Balkans, where they waited out the cold spell. Their population sizes were
drastically reduced, and much of the genetic diversity that had previously
existed in Europe was lost.
Beginning about 15,000 years ago after the ice sheets had begun their retreat
humans moved north again and recolonized western Europe. By far the most
frequent mitochondrial lineage carried by these expanding groups was haplogroup
H. Because of the population growth that quickly followed this expansion, your
haplogroup now dominates the European female landscape.
Today haplogroup H comprises 40 to 60 percent of the gene pool of most European
populations. In Rome and Athens, for
example, the frequency of H is around 40 percent of the entire population, and
it exhibits similar frequencies throughout western Europe. Moving eastward the
frequencies of H gradually decreases, clearly illustrating the migratory path
these settlers followed as they left the Iberian Peninsula after the ice sheets
had receded. Haplogroup H is found at around 25 percent in Turkey and around 20
percent in the Caucasus Mountains.
While haplogroup H is considered the Western European lineage due to its high
frequency there, it is also found much further east. Today it comprises around
20 percent of southwest Asian lineages, about 15 percent of people living in
Central Asia, and around five percent in northern Asia.
Importantly, the age of haplogroup H lineages differs quite substantially
between those seen in the West compared with those found in the East. In Europe
its age is estimated at 10,000 to 15,000 years old, and while H made it into
Europe substantially earlier (30,000 years ago), reduced population sizes
resulting from the glacial maximum significantly reduced its diversity there,
and thus its estimated age. In Central and East Asia, however, its age is
estimated at around 30,000 years old, meaning your lineage made it into those
areas during some of the earlier migrations out of the Near East.
Haplogroup H is a great example of the effect that population dynamics such as
bottleneck events, founder effect, genetic drift, and rapid population growth,
have on the genetic diversity of resulting populations.
Anthropology vs. Genealogy
DNA markers require a long time to become informative. While mutations occur in
every generation, it requires at least hundreds normally thousands of years for
these markers to become windows back into the past, signposts on the human tree.
Still, our own genetic sequences often reveal that we fall within a particular
sub-branch, a smaller, more recent branch on the tree.
While it may be difficult to say anything about the history of these sub-groups,
they do reveal other people who are more closely related to us. It is a useful
way to help bridge the anthropology of population genetics with the genealogy to
which we are all accustomed.
One of the ways you can bridge this gap is to compare your own genetic lineage
to those of people living all over the world. Mitosearch.org is a database that
allows you to compare both your genetic sequence as well as your surname to
those of thousands of people who have already joined the database. This type of
search is a valuable way of inferring population events that have occurred in
more recent times (i.e., the past few hundred years).
Looking Forward (Into the Past): Where Do We Go From Here?
Although the arrow of your haplogroup currently ends throughout Western Europe,
this isn't the end of the journey for haplogroup H. This is where the genetic
clues get murky and your DNA trail goes cold. Your initial results shown here
are based upon the best information available today but this is just the
beginning.
A fundamental goal of the Genographic Project is to extend these arrows further
toward the present day. To do this, Genographic has brought together ten
renowned scientists and their teams from all over the world to study questions
vital to our understanding of human history. By working together with indigenous
peoples around the globe, we are learning more about these ancient migrations.
Help Us Find More Clues!
But there is another way that we will learn more about the past. By contributing
your own results to the project, you will be allowed to participate anonymously
in this ongoing research effort. This is important because it may contribute a
great deal to our understanding of more recent human migrations. Click the
yellow button below in the "Help Us Tell the Story" section of your results
profile to learn more about this. It's quick, easy, and anonymous, but will help
us further refine our analyses.
Don't Be a Stranger
Finally, keep checking these pages to follow along with the project and our
latest findings; your results profile will be automatically updated to reflect
any new information that may come to light based on the research.
Notes.
La liste des lettres de la séquence (CRS) de la région HVR1 de 16 001 à 16 569
qui est présentée sur le site de National Geographic est la liste de ma
séquence. Sur FTDNA on présente la liste du CRS de référence et en retrait les
modifications à cette liste. Ainsi avec 16093C, 16129A, 16316G, 16519C, ça
indique qu'à la position
16 093 un C a remplacé un T
16 129 un A a remplacé un G
16 316 un G a remplacé un A
16 519 un C a remplacé un T
par rapport à la séquence de référence.
CRS : Cambridge Reference Sequence. Voir
CRS pour sa
définition.
Dernière modification : vendredi 13 décembre 2024